Yseq dna test. Forward Primer: Y12419_F Reverse Primer: Y12419_R www.

Yseq dna test Convert your WGS results (CRAM or BAM files) from: Dante Labs, Nebula, Sequencing, YSEQ to the most RAW common formats compatible with third-party DNA websites. Y-SNP chip tests are available from the 23andMe and Living DNA. hg38 Position: ChrY:20706147. YSEQ DNA tests See Peter's answer to How do I add a YSEQ DNA test? I suspect that other elite yDNA tests (YFull, etc) should be handled the same, as an Other yDNA test. Forward Primer: A17397_F Reverse Primer: A17397_R hg38 Position: ChrY:16037104. 1 / Beta) Logo designed by Chris Rottensteiner. I have done larger scale Y DNA The test taker shouldn't eat or drink anything, or brush his or her teeth, for at least 30 minutes before the samples are taken. [Epub ahead of print] Just the DNA test and the Nutrahacker upload saved me from needing additional bloodwork, etc. More comprehensive sequencing tests using next generation sequencing technology are available from Full Genomes Corporation, Family Tree DNA and All you need to know about health and ancestry DNA tests before you order. YSeq is a reputable company In the autosomal DNA tests of 23andme and Living DNA, the Y-haplogroup and the mt-haplogroup are displayed directly. They were pioneers of yDNA testing and located in Germany before being acquired by FamilyTreeDNA in 2006 and moving to Houston. hg38 Position: ChrY:8123820. hg38 Position: ChrY:12069266. Genotyping DNA Tests Traditional consumer DNA tests only provide data on up to 2 million data points, compared to the complete 6 billion analysed in a whole genome sequencing test. The Y chromosome (Y-DNA) is a DNA structure found in the nucleus of a male cell. When talking about two or more Y-Chromosome STR haplotypes, Genetic Distance (GD) is the total number of differences, or mutations, between two sets of results. Find out which foods suit you better or worse and countless other details with our rapid DNA test. Forward Primer: YP4889_F Reverse Primer: YP4889_R DNA testing in itself is not illegal. Genealogy Junkie, 16 January 2014. 20706147 Ancestral: T Derived: C Reference: Full Genomes (2014) ISOGG Haplogroup: J1 (not listed) Comments:. If the levels are too high, The Dante test we specifically included one of their low-map, low result returned tests to show how the RAW average read depth and the mapped / actual read depth differ significantly. 00. You cannot easily mail an International kit back to the USA. 15572844 Ancestral: A Derived: G Reference: Underhill et al. Y-DNK test. This is $161 less than the old price of $740. YSEQ primarily does Y However, some particular Y-SNP and Y-STR markers have been identified to help with this and these are available for testing at YSEQ. YSEQ primarily does Y chromosome STR testing. YFull YTree v12. Then enter the haplogroup, and in the note box, identify the test and STR/SNP results. . Accepts uploads of raw data files from Ancestry DNA and 23andMe. Forward Primer: Z27263_F Reverse Primer: Z27263_R hg38 Position: ChrY:17329777. Aligned sequencing reads. The panel contains the following 3 markers: - FT20095 - 8855748 A > C (Hg38) This SNP is from a common ancestor to every descendant of our 4 original Immigrant brothers who came to America in 1730. Developed by Hunter Provyn and Thomas Krahn (2022). The lower the number, the closer you are related. Whole Genome Sequencing Vs. Autosomal DNA tests (atDNA) do enjoy growing popularity. This panel is suggested when you have tested L238+ or if you have a clear prediction for this haplogroup according to your Y-STR results. ISOGG Haplogroup: E1b1a1a1a2a1a3a2b~ (not listed) Comments: Below M4197; approx with M4207 Forward Primer: CTS7822_F Reverse Primer: CTS7822_R Y-DNA Genetic Distance. What many people don’t know is that all autosomal tests include information in the form of SNPs Besides Family Tree DNA, other DNA testing companies that offer Y chromosome testing include FullGenomes at www. Upstream of M122. Based on my testing, AncestryDNA is the best DNA test kit for y-chromosome analysis. The test taker shouldn't eat When FTDNA does not offer single SNP tests that cover unique markers in your genetic tree, you can “wish” the SNPs and then test with a company called YSeq. Magoon et al. The perfect start for your DNA testing journey. The chart does note that Nebula's results are clinical grade, while YSeq results are not, so if you're using the test strictly for genealogical purposes, then it really doesn't matter, but if you're interested in the results from a medical standpoint, then you might want to stick with Nebula (even though they're a real pain in the ass to deal with). STR Testing Strategy. 19017215 Ancestral: C Derived: T Reference: Yan Shi (2011) ISOGG Haplogroup: I2a (not listed) Comments: Equiv. Layers . Please take two samples for each person. So even with the 30% longer sequence read length, it is not enough to overcome the lower average read depth of the WGS400 test kit. How do I add a YSEQ DNA test? +8 votes . to L621/S392. (2013) ISOGG Haplogroup: E1b1b1a1b1a (not listed) Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018 Forward Primer: Z5017_F AGTATACAGTTACAATTTTCTGTCCAATGA Reverse Primer: Z5017_R You can copy and paste STRs from public projects as well as automatically import STRs from all public YSEQ projects. For Genealogists: With this DNA test we start with 5 key SNPs: L47 Z9 Z2 Z8 Z326 and then we work down the branches iteratively until we have found your position on the given tree. Affordable online genetic tests is already a reality that goes far beyond mere curiosity. Top. Upload your MH raw data to cladefinder. For 6 years they innvoated at FTDNA concluding with the release of the BigY test based on NGS technology — the first for the genetic genealogy Discover your DNA story and unlock the secrets of your ancestry and genealogy with our autosomal DNA, Y-DNA, and mtDNA tests. Intensity . All-in-all, the YSEQ WGS400 test looks like a fantastic step forward in the genetic genealogy field. Whole genome sequencing decodes 100%. 7% 1. 32, 12305 Berlin, Germany ♦ info@yseq. I only did an autosomal test - cannot afford the mtDNA test If you had a Y-DNA or a mtDNA test you could compare and match with people from various DNA testing companies. September 9, 2022. FullGenomes offers a test similar to the Big Y called the Y Elite test for $425. 8266310 Ancestral: T Derived: C Reference: FTDNA (2018) ISOGG Haplogroup: J2 Comments: Below M67 > Z515 > Y20196 Forward Primer: FGC64332_F Reverse Primer: FGC64332_R The test is completed when the unique phylogenetic position on the tree has been determined. I believe it was about 2013 when Thomas and Astrid Krahn created YSEQ. YSEQ is definitely not just a less expensive alternative to the bigger companies. The Family Tree Guide to DNA Testing and Genetic Genealogy by Blaine Bettinger, 2016 How to do a Y-DNA Study by James Rader, 2017 hg38 Position: ChrY:7821989. net ♦ www. How long does it take to get my Big Y-700 results? Big Y-700 is a comprehensive test; therefore, processing times are typically longer than our other testing services. Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG Buy a DNA test: Basal Haplogroup Test Price: 6000. The Y-DNA data from these tests is of lower quality, but may still suffice for a very, very general Y-DNA haplogroup classification. 1% 1. The Whole Genome Test is recommended to female and male test takers. The individualized report of haplogroup findings is a nice touch. hg: R-L11 parallel to P312 and U106 Derived in PGP45 and PGP124 Forward Primer: gggtttggatgtaaacatatgag Reverse Primer: gagacatagtctcactctgcaccc mitoYDNA. These attributes make it an invaluable tool for anyone looking to delve into their paternal history. Journal of Forensic Science. YFull helped me to get understandable outcomes from the result. 16504680 Ancestral: A Derived: T Reference: FTDNA (2017) ISOGG Haplogroup: R Comments:. YSEQ has long been a player in the market since formed when Thomas and Astrid Krahn left FamilyTreeDNA back in 2012 or so. For genetic genealogy purposes NGS is used for the BIG Y test from Family Tree DNA and the Y Prime, Y-Elite, and whole-genome sequencing tests hg38 Position: ChrY:19017215. Use keywords to find the product you are looking for. Depending on the result of DF13 and Z39589 the most frequent occurring markers downstream from DF13 or Z39589 are tested. com for deep YDNA analysis. Upload your raw data from major testing companies like 23andMe, AncestryDNA, FamilyTreeDNA, and YSEQ DNA Shop to connect with others who share your paternal lineage. 50 test for SNP S310 (a. See this tree diagram to understand the groupings in this panel: YSEQ reserves the right to replace not working SNPs against phylo-equivalent alternatives if necessary. net (formerly the DNA Fingerprint project also) from Thomas and Astrid Krahn. fullgenomes. It is also known as second generation sequencing (SGS) or massively parallel sequencing (MPS). 0 License Legal / Contact Github repo: hprovyn/hras. 45 Gbases coverage . Radius: 200 km. You will have everything you need to know Besides, it will give you a recommendation for further SNP testing at Yseq. 16037104 Ancestral: G Derived: A Reference: Yan Shi (2011) ISOGG Haplogroup: O2 Comments: Found in a hg O3 person. 00PKR A simple test of the DYS464 STR to predict your basal Y-DNA haplogroup. Additional Links For more information, please see the following links: YSEQ Cladefinder Free tool to identify the best position on the YFull YTree from positive and negative SNP results. This will give a rough estimate of your Y-haplogroup, provided you are male <-- if yes, check the result on the As for mt-dna result, it will come "for free" with the WGS result from Nebula or Dante or Yseq WGS++of if you want to do a dedicated Full Squence mt-dna test : -FTDNA , $149 (will put you on their mt-tree and matching database, R-S20782 and Subclades Research Project focuses on the R1bU152-L2-Z49-S8183-FT44656-S20782 haplogroup and its subclades. 495 views. hg38 Position: ChrY:14663733. Beside individual yDNA SNP testing, they are best known for their processing of WGS test results to gain the maximum extraction in haplogroup work. WHO CAN JOIN: anyone who has been found to be S20782+ or downstream SNPs by YSEQ, Full Genomes Corp, 23andme, Dante Labs, FTDNA. I found that I had problems with "normal" b-12, B-6, vitamin e, and folinic acid I've been tested using Ancestry, 23andMe, LivingDNA, and YSEQ. With this DNA test we start with 4 key SNPs CTS9857 Z63 CTS6364 Z58 / S244 and then we work down the branches iteratively until we have found your position on the given tree. Then, a few months later I ordered another simple mtDNA test (with a samle from my father), and I've been waiting for the results for 7 months Y-SNP testing is required to confirm haplogroup assignments, to learn more about your deep ancestry and to rule out false positive matches. Yes, there is. Forward Primer: YFS444733_F Reverse Primer hg38 Position: ChrY:11332887. Buyer beware links. 20101472 Ancestral: G Derived: T Reference: FTDNA (2018) ISOGG Haplogroup: unknown Comments:. Genealogy Junkie, 14 May, 2014. SNP Test SadaatDNA partners with the YSeq Lab in Berlin, hg38 Position: ChrY:12831629. 05. 02%) of the DNA. A demonstration of linking your YSEQ testing results with your YDNA-Warehouse test subject. At FTDNA they extended and pioneered many new yDNA testing products. YSEQ claims that 400 base reads on their WGS400 product is superior. ) including calculating the time to the most recent common ancestor. Here are upload Instructions for Y-DNA and mtDNA from Family Tree DNA (the most popular Y-DNA and mtDNA testing lab). hg38 Position: ChrY:17176853. hg38 Position: ChrY:8266310. YSEQ (30x whole genome sequencing) This Y-DNA SNP testing chart provides comparative information on the Y chromosome SNP tests offered by the major DNA testing companies. The Convert your WGS results (CRAM or BAM files) from: Dante Labs, Nebula, Sequencing, YSEQ to the most RAW common formats compatible with third-party DNA websites. They started in the business with DNA Fingerprint which was acquired by FamilyTreeDNA in 2006. Advanced Search Next generation sequencing (NGS, NextGenSeq) is a new method for sequencing genomes at high speed and at low cost. Most DNA testing companies such as 23andMe and Ancestry analyze only a small portion (less than 0. Living DNA YSEQ; Date when product first went on sale: November 2010: November 2013: Late 2012: August 2015: September 2016: November 2013 Cost: YSEQ's $17. Holiday Sale: Discounts on Family Finder, Y-DNA, mtDNA, & All Bundles! Extended through Jan 6th. Title: Instructions for collection of the samples High resolution Y-DNA tests: WGS400 from YSEQ, Big Y-700 from FTDNA, WGS from Dante Labs. YSEQ mt Clade Finder (version 0. Setup YSEQ Result Imports. 17234820 Ancestral: A Derived: G Reference: Full Genomes Corp (2016) ISOGG Haplogroup: J1 Comments: Below Y5321 > Y5324 > Y5322 > Y9271 > Y5323 > Y5320 Forward Primer: FGC43126_F TATTCCCCAGGATGTACTGCAG Reverse Primer: FGC43126_R GCACATCCTGCACCTGTACTC hg38 Position: ChrY:15572844. net . There doesn't seem to be a dropdown option for YSEQ and I can't add it. hg38 Position: ChrY:6871618. 2013 May 17. Find out which test is the best suited for your own needs. 4% 1% mt Clade Finder is an mtDNA analytical tool developed by Hunter Provyn and Thomas Krahn of YSEQ that takes a FASTA file as input. Haplogroup Info section depicts a simplified tree view of the hg38 Position: ChrY:9322745. This brings the total cost for BOTH Y and MT-DNA testing and analysis to US$444, compared to FTDNA's BigY 700 test, which is ONLY testing Y-DNA, at US$449. And the site is free. Humans have 23 pairs of Chromosomes, 22 pair of autosomes and one pair of sex chromosomes, XX for females and XY for males. EDIT to avoid confusion Men only! dna; autosomal; y-dna; I only have one mother, one sister (both of whom have done DNA tests - these were done in 2018 & 2019) and female cousins still living. Recently, they have been funding Hunter It states that a YSEQ tests like WGS+ which has only 30x coverage and 150 base pairs has only a 1/3 or 1/4th the depth of FTDNA BIG Y. mitoYDNA accepts Y-DNA and mtDNA results from Family Tree DNA , YSEQ , GeneBase , African Ancestry , and Yoogene , as well as defunct labs: Gene Tree , DNA Heritage , Relative Genetics , SMGF, Ancestry , Y-STR haplotype tools (modals, genetic distance, TMRCA) The following is a selection of tools that can be used for a set of Y-STR values (DYS etc. YSEQ DNA Origins Project ♦ Kettinger Str. I think most researchers test: YSEQ Alpha STR panel ($58) followed by the; SNP panel of their haplogroup as predicted by the STRs ($88) For $146 they get: Guaranteed terminal subclade Because the PSHG uses both FTDNA and YSEQ for DNA testing, FTDNA Haplogroup listings may vary from the actual Haplogroups that are shown in the group headings of the Y-DNA Classic Chart due to YSEQ panel and single SNP test results. Information about our Whole Genome Sequencing DNA test is therefore incorporated into the review. Table of contents. 12069266 Ancestral: G Derived: A Reference: 23mofang (2018) ISOGG Haplogroup: O Comments:. SNP / Variant. YSEQ has not contributed any phenotyping data or created any statistical model by ourselves. org A crowdsourced Y-DNA and mtDNA database, with tools and analysis; MODIFIED Y-Utility by Colin Ferguson based on Dean ySeq. Upon leaving in 2013, they continued their efforts with this new organization they Their statistics page reports 10,976 total DNA kits, split almost evenly between Y DNA and mtDNA test types, with slightly more mtDNA tests. mitoYDNA. 26365592 Ancestral: G Derived: A Reference: G. yseq. AlMcCord Fochloc Senchada Posts: 11 Although I have been involved in this DNA testing for about three years, I am not all that adept at understanding the YDNA results I received from Full Genomes Inc. 90 Gbases coverage . Forward Primer: FGC12355_F Reverse Primer: FGC12355_R Among the autosomal DNA tests, 23andMe includes the most Y and mtDNA SNPs and you don't have to upload to a third party to get them. FREE standard shipping on all orders over $100! Over 389,000 single Y-SNPs are available in our catalog and the portfolio is growing every day. a R-L746) is 100% proof of whether or not a man is a patrilineal descendant of the first High Steward of Scotland (R-P312/S116 _ L21/S145 _ DF13 _ Z39589 _ DF41/S524 _ S775 _ L746. Forward Primer: ZS8597_F Reverse Primer It's now possible to do a WGS test with YSEQ, a reputable company operating within the European Union's data privacy laws, for $579. com and YSEQ at www. 6871618 Ancestral: A Derived: C Reference: Yfull (2014) ISOGG Haplogroup: Q Comments:. 9322745 Ancestral: C Derived: T Reference: FTDNA (2016) ISOGG Haplogroup: E Comments:. mtDNA Profiler The tool is described in: Yang IS, Lee HY, Yang WI, Shin KJ. 11332887 Ancestral: T Derived: G Reference: FTDNA (2018) ISOGG Haplogroup: unknown Comments:. Aka S22686 Forward Primer: A636_F Reverse Primer: A636_R If you do not have a good understanding of DNA tests and genetic genealogy, or if you don’t know exactly what you want tested, then YSEQ is probably not for you. The G refers to the location of this gene within this SNP. Relative Frequency. The Matches table provides information and links to your closest matches from samples within the NCBI database that have been analyzed by the YFull MTree. The Instructions for collecting DNA samples We have supplied 2 swabs for each person; each pouch containing one brush. This panel includes the following downstream panels in The test is completed when the unique phylogenetic position on the tree has been determined. Forward Primer: A19292_F Reverse Primer Use keywords to find the product you are looking for. The YDNA-Warehouse is a free community platform for sharing and analyzing Y-chromosome DNA sequencing data. Price starts at 6000PKR View Product. Forward Primer: Z29544_F Reverse Primer: Z29544_R The test is completed when the unique phylogenetic position on the tree has been determined. You will get the following results and files: RAW files compatible with all the known third-party DNA websites. I had an A2284 and an A5920 test(s) I recommend saying your haplogroup is R-A2284 and saying the above in the note field for your Y-DNA test information. 8123820 Ancestral: G Derived: A Reference: Y DNA community ISOGG Haplogroup: G2a2b2a1a1c1a2a1a Comments:. YSEQ is the world's largest source for Y chromosome tests forancestry and genealogy. They all have their advantages. If a marker downstream of DF13 or Z39589 is found positive, we will immediately proceed with the FREE downstream panel and continue testing until the most hg38 Position: ChrY:16504680. org A crowdsourced Y-DNA and mtDNA database with tools and analysis. If you’re used to autosomal DNA testing numbers (which are in the millions), these numbers may sound low, but far fewer people take these tests to begin with. YSEQ extracts the DNA in-house and performs a quality control test to assure the sample meets acceptable tolerance levels of bacterial contamination. mogu za 15ak dolara u laboratoriji YSEQ da ciljaju direktno te mutacije. The YDNA-Warehouse was designed to allow members to collect their testing from multiple labs into a single signature. Notes for UK (& Ex-US) residents re DNA testing companies. 2. net. Most DNA tests come with mailing boxes depending on where you are purchasing them. 23andMe, AncestryDNA, Family Tree DNA Family Finder. YDNA-Warehouse. 5% and over 2. R-ZZ37. These tests determine your haplogroup and subclade as well as genetic distance from all other persons tested at high resolution, and Posted by Joel Grant Faulisi in Facebook on 6 Sep 2021 (update 20 Nov 2021 with final STR review on YSEQ) we have the first publication of a test comparison with YSEQs new WGS400 test. Forward Primer: Y12419_F Reverse Primer: Y12419_R www. Upload 23andMe Panel Results for hg38 Position: ChrY:8199742. 23andMe test results include your mitochondrial DNA In the first round , I ordered a Y-DNA test and an mtDNA test at the same time. So I was satisfied. In general, it is found by summing the differences between each STR marker. A minimap2 driven algorithm that takes a FASTA and returns closest matches from NCBI dataset, mapped hg38 Position: ChrY:17234820. Thanks to YFull, I am now in This panel is recommended to Morrison family members in haplogroup R1b-A40. Forward Primer: FGC10668_F Reverse Primer: FGC10668_R hg38 Position: ChrY:20101472. Forum: Travel: Ecology: Facts: Genetics: History: Linguistics: Psychology: Forum: Actually YSEQ mentions that 10 novel (Y-DNA) mutations in your sample will be verified by Sanger sequencing. Big Y coverage. R-ZZ37 you can “wish” the SNPs and then test with a company called YSeq. Griffith S. 7821989 Ancestral: C Derived: A Reference: Full Genomes Inc (2014) ISOGG Haplogroup: R1b1a2a1a2c1f2 (not listed) Comments: Found in a R1b-Z2534 person Forward Primer: FGC8258_F TCAGGTTTCAGGCAAGAATG Reverse Primer: FGC8258_R TCTCCTGCCTGGACAGTCTC If you have already taken a Y-DNA test with FamilyTreeDNA, just log in to your account and click “Add-ons & Upgrades” to upgrade your Y-DNA test to Big Y-700. mtDNAprofiler: A Web Application for the Nomenclature and Comparison of Human Mitochondrial DNA Sequences. While this is sufficient for a basic overview of your health, fitness and nutritional data, many important factors go amiss. These are mostly advertised with the ethnicity estimations and offer databases for the so-called “matching” The DNA test that can tell your haplogroup is the 23andMe Ancestry + Traits Service, which is usually available directly on the 23andMe website for about $99. See this tree diagram to understand the groupings in this panel: Which DNA testing company should I use? Genie1 blog (a review from the perspective of people living in Australia and New Zealand] Griffith S. 8199742 Ancestral: A Derived: G Reference: Gregory Magoon (2012) ISOGG Haplogroup: R1b1a1a2a1b Comments: downstream of L51; parallel to P310 et al. A SNP (Single-nucleotide A quality DNA test kit for y-chromosome analysis provides accurate lineage tracing, connects you with paternal relatives, and offers insights into genetic markers. Dakle, ne moraju da rade tako skupe testove kako bi to saznali. Y Chromosome Coverage Histograms from Y-DNA Warehouse. MacArthur D. Group E-V12 Alleles Browser This group is intended for those who have a positive test for E-V12 (B37 location 6823099; allele change A to G). Features . Forward Primer: Y23110_F Reverse Primer: Y23110_R The 30x WGS is an excellent tool to discover your genome with a rapid turn around for raw data. Y-DNK test mogu raditi samo muškarci iz razloga što samo muškarci poseduju Y hromozom. Disclaimer: We've written this Phenotype Predictor tool to visualize and verify the statistical model that others have published. This analysis fully determines an individual’s genetic makeup, and reports are based on the entire genome. Ready to test your DNA: how to The R1b-L21 Superclade Panel is tested in several stages: First DF13 and Z39589 are tested. mitoYDNA also accepts Y-DNA and mtDNA results from other labs such as: YSEQ , Genebase , African Ancestry , Yoogene or from defunct labs: Gene Tree , This is a 2 round panel that pinpoints the terminal SNP below L238. BAM files ready to be uploaded to YFULL. k. Where the legality lies is in the transport of the biological sample via the mails over international boarders. In the FTDNA, DNA Results – SNP’s section, the Y-SNP’s listed by the PSHG at FTDNA tests do not list the . This is useful if you need to make a very basic Y-DNA comparison between two men: if for instance one man is R1b and the other man is I1, then you can be certain their patrilineal connection is not genealogically significant. 7 Facts from The red checkmark next to some of these SNPs means that they can be verified through YSEQ. 14663733 Ancestral: C Derived: T Reference: Andy Gierson (2013) ISOGG Haplogroup: R1b1a1a2a1a3 Comments: Approx. Optionally in zip / gzip compression. commented Jun 14, 2017 by Peter Roberts G2G6 Pilot hg38 Position: ChrY:26365592. The Y chromosome is passed on without recombination by a father to his sons. This panel is recommended for persons who tested I1-M253+ before or who have a clear prediction for this haplogroup. It took around 2-3 months and the results were much more detailed than those that LivingDNA provided. The test is completed when the unique phylogenetic position on the tree has been determined. 17329777 Ancestral: del Derived: ins Reference: Full Genomes Corp (2015) ISOGG Haplogroup: unknown Comments:. Y-DNA Relative Frequency (Classic) Developed by Hunter Provyn and Thomas Krahn Apache 2. 12831629 Ancestral: A Derived: T Reference: DNAChron (2022) ISOGG Haplogroup: R1a Comments:. 17176853 Ancestral: G Derived: A Reference: FTDNA (2016) ISOGG Haplogroup: R Comments: Aka V3990 Forward Primer: A10759_F Reverse Primer: A10759_R Y-DNA Relative Frequency (Classic) Developed by Hunter Provyn and Thomas Krahn Apache 2. The hidden potential of atDNA tests, for Y-DNA projects. mdqgm ltqd zasmw bmoim rxuiimnl yrvchq dzemp rtxgffz jncn nnkia